Artículo sobre ...

Tratamiento del Helicobacter Pylori con Omeprazol, Amoxicilina y ...

177 TRATAMIENTO DEL HELICOBACTER PYLORI CON OMEPRAZOL, AMOXICILINA Y CLARITROMICINA Tratamiento del Helicobacter Pylori con Omeprazol, Amoxicilina y Claritromicina en esquemas de 7 y ...

Enviado* el 31/12/2010 18:00
177 TRATAMIENTO DEL HELICOBACTER PYLORI CON OMEPRAZOL, AMOXICILINA Y CLARITROMICINA Tratamiento del Helicobacter Pylori con Omeprazol, Amoxicilina y Claritromicina en esquemas de 7 y 10 días RESUMEN OBJETIVO: La terapia de un inhibidor de la bomba de protones más dos antibióticos es el tratamiento más aceptado para la infección por el Helicobacter pylori. Sin embargo,       no hay consenso sobre su duración. El objetivo fue comparar los porcentajes de erradicación del esquema de omeprazol+amoxicilina+claritromicina administra- dos durante 7 vs 10 días. METODOLOGÍA: Seleccionamos pacientes del Hospital Militar Central y Policlínico Peruano-Japonés con síntomas del tracto gastrointestinal superior y Helicobacter pylori. Excluimos aquéllos con úlcera péptica. Para el diagnóstico se tomaron biopsias para la prueba de la ureasa, PCR, cultivo y coloración con plata. Empleamos omeprazol+claritromicina+ amoxicilina, durante 7 días versus 10 días. Realizamos endoscopía control al mes de terminado el tratamiento, y utilizamos técnicas de biología molecular para diferenciar las recurrencias de las reinfecciones. Evalua- mos la susceptibilidad a claritromicina. RESULTADOS: Incluimos 36 pacientes en cada grupo. En ambos la erradicación fue igual: 86.1% (31/36). En varios pacientes en que persistió la bacteria se identificó la misma cepa que la inicial. El 91.18% de nuestras muestras fueron sensibles a claritromicina. CONCLUSIONES: En el Perú la combinación de omeprazol+claritromicina+amoxicilina para erradicar la infección por el Helicobacter pylori da resultados superiores al 80%. El  esquema de 7 y 10 días erradicó a la bacteria en el 86% de nuestros pacien- tes. PALABRAS CLAVE: Helicobacter pylori, tratamiento, ensayo clínico. Wilson Rodríguez1, Arturo Pareja Cruz2, Luis Yushimito2, Alberto Ramírez Ramos3,4 , Robert H. Gilman3,4, José Watanabe Yamamoto4,5, Carlos Rodríguez Ulloa4,5,  Daniel Mendoza Requena3, José Guerra Valencia3, Julio Leey Casella3, Erick Chinga Alayo3,6, Billie Velapatiño3, Teresa Valencia3. 1 Hospital Militar Central - Dpto. de Gastroenterología 2 Departamento Médico - MEDCO 3 Universidad Peruana Cayetano Heredia 4 Grupo de Fisiología Gastrointestinal de la Universidad Peruana Cayetano Heredia y  Universidad John Hopkins 5 Policlínico Peruano-Japonés. 6 Cook County Hospital - Dpto. de Medicina, Chicago - Illinois REV. GASTROENTEROL. PERÚ 2003; 23: 177-183
178 Rodríguez y col. S S S S S e acepta que el tratamiento ideal de la infección     por el Helicobacter pylori debe ser simple,     efectivo en todos los casos, de bajo cos- to y libre de efectos secundarios. Sin embargo,    hasta el presente no hay un esquema terapéutico que cumpla plenamente con es- tos requisitos, pero sí existen muchos que se acercan al trata- miento ideal (1). Desde hace cerca de dos décadas el Grupo de Fisiología Gastrointestinal de la Universidad Peruana Cayetano Heredia y de la Universidad de Johns Hopkins ha venido estudiando diversos esquemas de tratamiento. Inicialmente monoterapia, luego terapia doble y terapia triple, cuyos resultados han sido publicados (1-3). Al presente hay alrededor de un centenar de esquemas que han sido propuestos y estudiados (dobles, triples, cuádruples        y de variada duración), teniendo muchos de ellos por- centajes de erradicación por encima del 80% que es el mínimo   de erradicación que se ha aceptado como satisfactorio. Los problemas con estos esquemas son de un lado el por- centaje de efectos secundarios, de otro su adecuado cumpli- miento por parte de los pacientes y el costo. La evidencia disponible hasta la fecha, revela que los esquemas de tratamiento con los que se obtienen mayores porcentajes de erradicación son los triples, y entre ellos la com- INTRODUCCIÓN binación de claritromicina + amoxicilina + omeprazol es el que tiene menor número de efectos secundarios, es más simple    de administrar, y proporciona elevados porcentajes de erradicación. Sin embargo, la duración del tratamiento no está bien definida. Se han evaluado esquemas de 7, 10 y 14 días con resultados diversos (4-6). En el Perú el esquema de 14 dias de tratamiento ha sido estudiado en un importante número     de pacientes con un porcentaje de erradicación de 93% (7). Merece remarcarse que si no se usan técnicas moleculares, no se puede diferenciar las recurrencias de las reinfecciones luego del tratamiento, lo cual tiene importantes implicancias clínicas y de salud pública, ya que para los pa- cientes que sufren recurrencias sería recomendable cambiar el esquema de antibióticos utilizados, basado en un análisis de susceptibilidad antimicrobiana, mientras que para los ca- sos con reinfecciones se puede utilizar el esquema inicial. En cuanto al contexto de la salud pública, las recurrencias indican    factores asociados a resistencia bacteriana o uso irracio- nal de antibióticos,  mientras que las reinfecciones apuntan a una fuente continua de infección, considerando que en nues- tro país las principales vías de transmisión son la fecal-oral y a través del agua (2,8). Considerando los aspectos anteriormente presentados, creímos pertinente realizar este estudio, con el objeto de pre- sentar nuestra experiencia al comparar la eficacia y el perfil de reacciones adversas de un esquema triple aplicado en períodos       de tratamiento de 7 y 10 días. SUMMARY AIM:  The most accepted treatment for infection by Helicobacter pylori is the proton pump inhibitor based therapy with two antibiotics.  However, there is no consensus regarding the duration.  The purpose here was to compare eradication percentages in the omeprazole + amoxicillin + clarithromycin regimen administered during 7 days versus 10 days and confront the results with a previous 14-day* experience in Peru. METHOD:  Patients from the Central Military Hospital and Peruvian-Japanese Hospital evidencing chronic upper gastrointestinal tract symptoms were recruited.  We excluded patients with peptic ulcer.  Biopsies were taken for diagnosis, for urease and PCR tests, culture and coloring with silver.  Omeprazole + clarithromycin + amoxicillin was used during 7 days versus 10 days.  Control endoscopy was performed one month after treatment had been completed and molecular biology techniques were used to differentiate recurrences from new infections.  Susceptibility to clarithromycin was assessed. RESULTS:  36 patients were included in each group.  Eradication was the same in both groups:  86.1% (31/36).  In several patients in whom the bacteria persisted, the same initial nucleus was found.  In a previous study* using this same regimen during 14 days, a 93% eradication was obtained.  91.18% of our samples were susceptible to clarithromycin. CONCLUSIONS:  In Peru, the omeprazole + clarithromycin + amoxicillin combination gives results higher than 80% in the eradication of infection by Helicobacter pylori. The 7 and 10 days regimens eradicated the bacteria in 86% of our patients. KEY WORDS:  Helicobacter pylori, treatment, clinical trial.
179 TRATAMIENTO DEL HELICOBACTER PYLORI CON OMEPRAZOL, AMOXICILINA Y CLARITROMICINA MATERIAL Y MÉTODOS Pacientes El presente estudio se realizó en el Hospital Militar Central y en el Policlínico Peruano Japonés, ambos lo- calizados en la ciudad de Lima, Perú, habiéndose inclui- do los pacientes que eran referidos para esofagogastroduodenoscopía              por presentar síntomas crónicos del tracto gastrointestinal superior. Se excluyeron aquellos con úlcera gástrica o duodenal activa, cáncer gástrico, gastrectomizados, vagotomizados y quienes habían re- cibido en el curso de las últimas cuatro semanas, antibióticos, bismuto o inhibidores de la bomba de protones. Se consideró que un paciente tenía infección por el Helicobacter pylori cuando la biopsia gástrica sometida a coloración con plata era positiva, habiéndose realizado además la prueba de la ureasa y PCR. Los pacientes fue- ron distribuidos al azar para incorporarse al grupo de 7 y 10 días de tratamiento. El estudio fue abierto, sin embargo   fue ciego para el patólogo que evaluó las láminas. A partir de las cuatro semanas de terminar la terapia los pacientes fueron reexaminados mediante esofagogastroduodenoscopía              y biopsias para evaluar el porcentaje de erradicación. Determinamos el nivel socioeconómico de los pacien- tes de acuerdo a un cuestionario. Grupos de tratamiento Los pacientes se dividieron en dos grupos de tratamiento con similares características en grupos de edad, sexo, raza y nivel socioeconómico. Al grupo I se le administró Omeprazol 20mg, Amoxicilina 1g. y Claritromicina 500mg bid durante 7 días. Al grupo II se le dio el mismo esquema de medicación con la diferencia que el tratamiento se dio durante 10 días. Cálculo de la muestra Considerando una tasa de recaída de 0.3 en el gru- po de 7 días, y de 0.058 en el grupo de 10 días, con un poder de 80%, para detectar por lo menos una diferencia de 0.25, obtuvimos una muestra de por lo menos 36 personas      en cada grupo. Los datos de recaída los consegui- mos de una evaluación piloto que realizamos con los primeros      27 pacientes. Endoscopía La endoscopía se realizó como fue descrita anteriormente (9). Los endoscopios flexibles utilizados eran de marca Fujinon modelo EG450 HR. Previo al examen, para prevenir la contaminación,          los endoscopios, fueron lavados y esterilizados cuidadosamente con soluciones antimicrobianas (glutaraldehído, endozime). Se tomó 3 biopsias en cada paciente, una para la coloración       con plata, otra para la prueba rápida de la ureasa, y la tercera para el estudio de PCR. Estudios Histológicos Las biopsias para estudio histológico se fijaron en formol neutro. Luego de su inclusión en parafina, se efectuaron cor- tes de 3-4 micras de espesor coloreándose con plata (método de Warthin Starry). Las muestras fueron leídas por un patólogo experto. Prueba Rápida de la Ureasa Una biopsia del antro se colocó en agar-úrea procediéndose a realizar la lectura a los 15-30 minutos, y 16, 12 y 24 horas respectivamente.  Se consideró la prueba posi- tiva cuando se visualizó la variación de color del amarillo a rojo grosella. Cultivos bacteriológicos Se evaluó mediante cultivo a un total de 256 pacientes. En todos los casos, los cultivos fueron obtenidos de las biopsias del antro. Se utilizó el método estándar para el creci- miento de la bacteria en condiciones de microaerofilia (5% de oxígeno, 10% de dióxido de carbono y 85% de nitrógeno),     en agar DIFCO BHI (brain Herat infusion) suplementado con 10% de sangre de caballo o de carnero (7). Susceptibilidad antimicrobiana La susceptibilidad antimicrobiana fue realizada para el antibiótico claritromicina en 36 muestras mediante el método del E-test (AB Biodisk, Solna, Sweden), según Valdez et al (10). La concentración inhibitoria mínima (MIC) fue definida como la menor concentración del antibiótico que resultó en una inhibición completa (ausencia de colonias). Para la resis- tencia a claritromicina se consideró un valor mayor o igual a 0.125 ug/ml. Reacción en Cadena de Polimerasa (PCR) Los fragmentos de ADN del H. pylori fueron amplifica- dos mediante el uso de primers dirigidos al gen de la Ureasa, en un volumen de reacción de 25 ul  que conteniendo 2 mM de MgCl2, 0.25 mM de dNTPs, 0.4 uM de cada primer, 1X de Buffer, 0.02 U/ul Taq Polimerasa, y 5 ul del ADN extraido. Los siguientes oligonucleotidos, los cuales fueron usados como cebadores o primers, fueron derivados de la secuencia del gen de la ureasa (ureB) reportados por Jeong et al (11). UreaseB-F (5'CGTCCGGCAATAGCTGCCATAGT) y UreaseB- R (GTAGGT CCTGCTACTGAAGCCTTA). Las temperaturas que se usaron fueron las siguientes: 1 min a 94°C, 1 min a 67 °C y 1 min a 72 °C. Se realizaron 35 ciclos de amplificación, luego una corrida electroforética en agarosa al 2% con bromuro de etidio en la muestra. Se observó bajo iluminación     ultravioleta evidenciandose la presencia de un fragmen- to de banda amplificado de un tamaño de 467 pares de ba- ses. Ensayo de RAPD-PCR (Ramdom Amplified Polymorphic DNA-PCR) Utilizando muestras de los cultivos, se evaluaron 4 pa- cientes que permanecieron positivos después del tratamien-
180 Rodríguez y col. to, mediante la técnica de Amplificación de Polimorfismos de ADN al Azar (RAPD) usando los procedimientos y condicio- nes descritos en Soto et al (7). Este análisis determinó la dife- rencia entre cepas comparando los patrones de migración de ADN en un gel de electroforesis usando 4 cebadores diferen- tes. Análisis estadístico Consideramos eficacia como: número de pacientes sin infección por el Helicobacter pylori en la endoscopía control/ Número de pacientes que culminaron el tratamiento. Consi- deramos recurrencia como el hallazgo de la misma cepa que la identificada antes del inicio del tratamiento. Consideramos reinfección como el hallazgo de una cepa diferente a la iden- tificada antes del tratamiento. Las variables que incluimos fue- ron edad, sexo, condición socioeconómica, y cumplimiento del tratamiento. Utilizamos la t de students para comparar las variables numéricas, y el chi cuadrado para las variables categóricas. Consideramos como significativo un p<0.05. Para la elaboración       de la base de datos y el procesamiento utilizamos el programa estadístico SPSS 9.0. Aspectos éticos El estudio fue aprobado por el Comité de Ética del Hospital      Militar Central y del Policlínico Peruano Japonés. A to- dos los pacientes se les solicitó un consentimiento informado y se les explicó el objetivo del estudio, el tratamiento y los posibles efectos secundarios. RESULTADOS Pacientes Evaluamos endoscópicamente a 256 pacientes con síntomas crónicos del tracto gastrointestinal superior     (152 en el Policlínico Peruano Japonés y 104 en el Hospital Militar Central). De ellos, encontramos infección        por el H. pylori en 105 (41%) pacientes, de los cuales 9 no desearon participar, incluyéndose final- mente en el estudio a 96 pacientes: 48 del Hospital Militar Central (23 en el Grupo I de 7 días y 25 en el Grupo II de 10 días de tratamiento) y 48 del Policlínico Peruano Japonés (25 en el Grupo I y 23 en el Grupo II), asignándose 48 al Grupo I y 48 al Grupo II. Todos ellos recibieron tratamiento completo, pero no acudie- ron al control 12 (25%) personas de cada grupo, por- que no fue posible contactarlos nuevamente, algunos no desearon realizarse la endoscopía control y otros por motivos de viaje. Al final, realizamos el análisis de las tasas de erradicación       en 36 personas en cada grupo. Los grupo I y II fueron comparables en cuanto a edad promedio (42 vs 45 años) (p=NS), y porcentaje de mujeres (50% (18/36) vs 52.6% (20/38), p=NS) respectivamente; todos fueron de raza mestiza y procedentes de nivel socioeconómico medio o alto. Tasas de erradicación Logramos la erradicación en el 86.1% (31/36) de pa- cientes del Grupo I. El mismo valor logramos en el Grupo II. (Tabla 1). Los controles se realizaron después de 1 a 3 meses de culminada la terapia antibiótica. Pudimos realizar el RAPD en 4 de los 10 pacientes en los cuales no se logró erradicar al H. pylori. En todos ellos, las cepas identificadas después del tratamiento fueron las mismas que las iniciales, con lo que se descartó la posibilidad de reinfección. Tabla 1. Porcentaje de erradicación en cada grupo de tratamiento Grupo de 7 días Grupo de 10 días 86.1% (31/36) 86.1% (31/36) Susceptibilidad a claritromicina En 34 (47.2%) de las 72 muestras previas al tratamien- to, pudimos realizar análisis de susceptibilidad a claritromicina. 91.18% (31/34) de estas muestras fueron sensibles a claritromicina y 8.82% (3/34) fueron resistentes. En 2 de los 3 pacientes con muestras inicialmente resistentes se erradicó la bacteria después del tratamiento. También evaluamos 2 de las 72 muestras aisladas después     de recibir el tratamiento, de ellas 1 fue sensible, y la otra presentó resistencia intermedia. Reacciones adversas Ningún paciente fue retirado del estudio por haber presentado efectos secundarios moderados o severos. Las reacciones adversas fueron similares en los grupos I y II (Tabla 2), Ninguno presentó rash o reacción alérgica. Nin- guno fue hospitalizado debido a las reacciones adversas y no fue necesario suspender el tratamiento debido a los efectos secundarios. Tabla 2. Efectos Secundarios (%) Grupo I (n=36) Grupo II (n=36) Sabor amargo en la boca 34 (94.4) 35 (97.2) Dolor abdominal 18 (50.0) 19 (52.8) Náuseas 18 (50.0) 18 (50.0) Diarrea 9 (25.0) 10 (27.8) Cefalea 5 (13.9) 7 (19.4) DISCUSIÓN En el presente estudio, empleando este esquema durante 7 y 10 días hemos obtenido 86.1% de erradicación,  superan- do el porcentaje de erradicación de 80%, que es el porcentaje mínimo aceptado que debe de tener un esquema para elimi- nar al Helicobacter pylori (1).
181 TRATAMIENTO DEL HELICOBACTER PYLORI CON OMEPRAZOL, AMOXICILINA Y CLARITROMICINA Tabla 3. Resultados del Grupo de Fisiología Gastrointestinal de la Universidad Peruana Cayetano Heredia y la Universidad de Johns Hopkins Grupo Tratamiento Nº Pacs. Erradicación % Nº días Tx I Amoxicilina 500 mg t.i.d. 61 22/45 14 días Subsalicilato de Bismuto 500 mg t.i.d. (49%) Tinidazol 500 mg t.i.d. Placebo 24 0/13 14 días II Tetraciclina 500 mg t.i.d. 66 32/54 14 días Subsalicilato de Bismuto 500 mg t.i.d. (59%) Tinidazol 500 mg t.i.d. Por 2 semanas adicionales: Tetraciclina 250 mg t.i.d. Subsalicilato de Bismuto 500 mg t.i.d. Placebo 24 01/16 14 días III Amoxicilina 500 mg t.i.d. 51 19/34 14 días Subsacilato de Bismuto 500 mg t.i.d. (56%) Metronidazol 500 mg t.i.d. Amoxicilina 500 mg t.i.d. 50 32/39 14 días Subsalicilato de Bismuto 500 mg t.i.d. (82%) Furazolidona 100 mg t.i.d. Resultados del Grupo de Estudio De Idiáquez, Bussalleu, Cok I Omeprazol 20 mg b.i.d. 24 18/24 7 días Claritromicina 500 mg b.i.d. (75%) Amoxicilina 1g b.i.d. II Tetraciclina 500 mg q.i.d. 19 18/19 7 días Furazolidona 100 mg q.i.d. (94.7%) Subcitrato de Bismuto Coloidal 120 mg q.i.d. III Tetraciclina 500 mg t.i.d. 20 19/20 10 días Furazolidona 100 mg t.i.d. (95%) Subcitrato de Bismuto Coloidal 120 mg t.i.d. Resultados del Grupo de Estudio Soto, Katz, Bautista, Razuri, Velapatiño, Gadea, Meza, Recavarren, Berg, Cadoz, Monath, Gilman y Taylor I Omeprazol 20 mg b.i.d. 252 201/252 14 días Amoxicilina 1 g b.i.d. 93% Claritromicina 500 mg b.i.d. Resultados del Grupo de Estudio Rodríguez Cuba W, Pareja A, Yushimito L, Ramírez Ramos A, Watanabe J, Rodríguez Ulloa C et al. I Om

Síguenos

Utilizamos cookies propias y de terceros para mejorar la experiencia de navegación, y ofrecer contenidos y publicidad de interés. Al continuar con la navegación entendemos que se acepta nuestra política de cookies.

X